Último Número: 206 Abril-Junio 2017

Técnico: Puesta a punto de la técnica de PCR multiplex para la identificación de Clostridium chauvoei y Clostridium septicum

Technical: Development of multiplex PCR for identification of Clostridium chauvoei and Clostridium septicum


VETERINARIA (Montevideo) - Vol. 49 - # 192 - Año 2013 - P. 15 a 19

Autores: Cattáneo, M.[1],2, París, N.2; Campos, F.3, Bermúdez,J.1,2

[1] Área de Bacteriología. Facultad de Veterinaria. UdelaR. Uruguay. Esta dirección electrónica esta protegida contra spambots. Es necesario activar Javascript para visualizarla

2      Laboratorio de investigación y desarrollo. CCA. Laboratorios Santa Elena. Uruguay.

3      Facultad de Veterinaria de Porto Alegre. UFRGS. Brasil.

Recibido: 12/3/2012 - Aceptado: 13/4/2012

ver versión PDF.


 

Introducción | Materiales y Métodos| Resultados | Discusión y Conclusión | Bibliografía

 

Resumen

Se describe la puesta a punto de la técnica de PCR multiplex para detectar el gen que codifica para la flagelina de Clostridium chauvoei y el gen que codifica para la toxina alfa de Clostridium septicum a partir de cultivos puros. Fueron utilizados primers específicos de los genes que codifican para la flagelina Clostridium chauvoei (516 pb) y la toxina alfa de Clostridium septicum (270 pb). Las cepas estudiadas de Clostridium chauvoei y Clostridium septicum fueron detectadas por la técnica de PCR multiplex observándose solamente la amplificación de los productos esperados de 516 pb y 270 pb respectivamente. No se observaron reacciones cruzadas entre Clostridium chauvoei y Clostridium septicum ni con las otras especies de clostridios estudiadas. El PCR multiplex fue eficiente en detectar Clostridium chauvoei y Clostridium septicum en forma separada y en conjunto.

Palabras clave: Clostridium chauvoei, Clostridium septicum, diagnóstico, PCR multiplex.

 


Summary

A multiplex PCR to detect the gene encoding the flagellin of Clostridium chauvoei and the gene encoding the Clostridium septicum alpha toxin from pure cultures was developed. Specific primers were used for genes encoding for Clostridium chauvoei flagellin (516 bp) and Clostridium septicum alpha toxin (270 bp). The strains of Clostridium septicum and Clostridium chauvoei were detected by multiplex PCR amplification. The expected products of 516 bp and 270 bp respectively were observed. There were no cross-reactions between Clostridium septicum and Clostridium chauvoei or with other clostridial species studied. The multiplex PCR was efficient to detect Clostridium septicum and Clostridium chauvoei separately and together.

Keywords: Clostridium chauvoei, Clostridium septicum, diagnosis, PCR multiplex.

 


Introducción

Clostridium chauvoei (C. chauvoei) es el agente etiológico del carbunco sintomático y Clostridium septicum (C. septicum) es uno de los agentes etiológicos de la gangrena gaseosa. El diagnóstico de estas enfermedades se realiza en base a los hallazgos clínicos y patológicos, siendo difícil el diagnóstico etiológico a nivel de laboratorio debido a diferentes factores como son la no realización de necropsia, remisión de material en forma equivocada, falta de laboratorios, equipamiento y de personal capacitado para trabajar en bacterias anaerobias (Stern y Batty, 1978; Assis y col., 2002; Radostits y col., 2002). El diagnóstico de laboratorio de estos agentes es complicado y muchas veces lleva a confusión y al diagnóstico etiológico erróneo debido a que C. septicum tiene un crecimiento más rápido en los cultivos en placas de agar sangre que C. chauvoei lo que enmascara el diagnóstico final (Stern y Batty, 1978; Assis y col., 2001). Con la técnica de PCR multiplex se busca tener mayor precisión y rapidez en el diagnóstico de estos agentes (Takeuchi y col., 1997; Kojima y col., 2001). El objetivo de este trabajo es poner a punto la técnica de PCR multiplex para detectar el gen que codifica para la flagelina de C. chauvoei y el gen que codifica para la toxina alfa de C. septicum a partir de cultivos puros.

 

(Volver arriba)



Materiales y Métodos

Las cepas utilizadas en este trabajo se detallan en el cuadro 1.

Cuadro 1: Cepas utilizadas para la puesta a punto de la técnica de PCR multiplex

 

Las muestras de ADN fueron extraídas con dos métodos, por ebullición a 100 ºC durante 20 minutos y con un kit marca SIGMA-NA2100 (Takeuchi y col., 1997; Kojima y col., 2001).

La PCR fue realizada en un volumen final de 25 μl, donde se variaron las concentraciones y volúmenes de MgCl2 (Invitrogen), primers (ALFA), Taq DNA polimerase (Invitrogen), y ADN genómico hasta la puesta a punto de la técnica. Los primers utilizados para C. chauvoei fueron 5´ATCGGAAACATGAGTGCTGC 3´ - 5´AGTCTTTATGCTTCCGCTAG 3´ y para C. septicum 5´AATTCAGTGTGCGGCAGTAG 3´-5´CCTGCCCCAACTTCTCTTTT 3´. El tamaño de los fragmentos esperados de la amplificación serian de 516 bp para C. chauvoei y de 270 bp para C. septicum. Fue utilizado un ciclo de desnaturalización de 94 ºC / 2 minutos, seguido de 35 ciclos de 94 ºC /30 segundos; 54 ºC/ 30 segundos; 72 ºC/ 1 minuto, y un ciclo de extensión de 72 ºC / 7 minutos. Se trabajó con un termociclador INFINIGEN modelo TC-96CG. Se utilizaron como controles positivos las cepas de C. chauvoei 10092 (ATCC) / BO17A (SESA) y C. septicum 61.10 (Instituto Pasteur, Francia) / BO23A (SESA). Para evaluar la especificidad se utilizaron las cepas de Clostridium sordellii 60.18 (Instituto Pasteur, Francia), Clostridium novyi tipo B IRP 307 (CVB-APHIS-USA) y Clostridium haemolyticium IRP 315 (CVB-APHIS-USA). Después de la PCR el material amplificado y separado por electroforesis fue visualizado en gel de agarosa al 1,5 % coloreado con Goodview (Beijing SBS Genetech Co. Ltd) Fue usado un marcador de peso molecular de 100 pb DNA Leadder (Generuler – Fermentas). Todas las cepas fueron trabajadas con el mismo protocolo.

 

(Volver arriba)

 


Resultados

La técnica de PCR se estandarizó para las siguientes concentraciones y volúmenes: PCR buffer 1 x, 1,5 mM de MgCl2, 0,2 mM de dNTP, 20 pmol de cada primers de C. chauvoei y C. septicum, 2 ul de ADN genómico de C. chauvoei, 1 ul de ADN genómico de C. septicum y 1.0 U de Taq DNA polimerase. No se obtuvieron resultados satisfactorios utilizando la extracción de ADN por ebullición para el caso de C. chauvoei y si para C. septicum. La extracción con kit de SIGMA-NA2100 fue positivo para C. chauvoei y C. septicum (Figura1 y 2).

Figura 1:

  • M1: marcador de peso molecular (100 pb DNA Ladder);
  • M2 cepa C. chauvoei 10092;
  • M3 cepa C. chauvoei B017A;
  • M4 primers de C. chauvoei con ADN de C. chauvoei B017A y ADN de C. septicum 61.10;
  • M5 cepa C. septicum 61.10;
  • M6 cepa C. septicum B023A;
  • M7 primers de C. septicum con ADN de C. septidum 61.10 y C. chauvoei 10092;
  • M8 primers de C. septicum con ADN de C. septicum 61.10 y C. chauvoei B017A;
  • M9 primers de C. septicum con ADN de C. septicum B023A y C. chauvoei 10092; M9 primers de C. septicum con ADN de C. septicum B023A y C. chauvoei B017A;  M11 primers de C. chauvoei con ADN de C. novyi tipo B;
  • M12 primers de C. septicum con ADN de C. sordelli:
  • M13 primers de C. septicum con ADN de C. haemolyticum;
  • M14 Control negativo.

 

 

Figura 2:

 

  • M1: marcador de peso molecular (100 pb DNA Ladder);
  • M2 cepa de C. chauvoei B017A:
  • M3 cepa de C. septicum 61.10;
  • M4 cepa de C. septicum B023A;
  • M5 primers de C. chauvoei y C. septicum con ADN de C. chauvoei B017A y C. septicum B023A.

 

(Volver arriba)



Discusión y Conclusión

Las cepas estudiadas de C. chauvoei y C. septicum fueron detectadas por la técnica de PCR multiplex observándose solamente la amplificación de los productos esperados de 516 pb y 270 pb respectivamente. No se observaron reacciones cruzadas entre C. chauvoei y C. septicum ni con las otras especies de clostridios estudiadas. El PCR multiplex es eficiente para detectar C. chauvoei y C. septicum en forma separada y en conjunto. Esta técnica complementará los procedimientos de laboratorio para el diagnóstico de las enfermedades clostridiales y la identificación molecular de cepas utilizadas en la producción de biológicos. El objetivo a futuro es mejorar esta técnica para la identificación de C. chauvoei y C. septicum directamente de muestras clínicas.

 

(Volver arriba)

 



Referencias Bibliográficas

1.     Assis RA, Lobato FCF, Martins NE et al. (2002). Surto de gangrena gaseosa em bovinos. Rev Port Cienc Vet 7:13-14.

2.     Assis RA, Lobato FCF, Dias LD et al. (2001) Producción y evaluación de conjugados fluorescentes para el diagnóstico de mancha y gangrena gaseosa. Rev Med Vet 82:68-70.

3.     Kojima A, Uchida I, Sekisaki T. et al. (2001). Rapid detection and identification of Clostridium chauvoei by PCR based on flageline gene sequence. Vet Microbiol 78:363-371.

4.     Radostits OM, Gay CC, Blood DC, Hinchcliff KW. (2002). Medicina Veterinaria. 9a. ed. Ed. McGraw. Enfermedades causadas por bacterias-II. Vol. I, p. 902-907.

5.     Sterne M, Batty I. (1978). Clostridios patógenos. Editorial Acriba. Zaragoza. España.

6.     Takeuchi S, Hashizume N, Kinoshita T. et al. (1997). Detection of Clostridium septicum hemolysin gene by polymerase chain reaction. J Vet Med Sci 59:853-855.

 

(Volver arriba)