Último Número: 208 Octubre-Diciembre 2017

Identificación de terneras Holando portadoras de BLAD y Citrulinemia en la región Este de Uruguay por PCR-RFLP y secuenciación

Identification of Holstein heifer’s carriers BLAD and Citrullinemia in the eastern region of Uruguay by PCR-RFLP and sequencing


Branda Sica A1*, Federici MT1**, Dutra F2, Romero A2, Briano C2, Dalla Rizza M1, Llambí S3

1Unidad de Biotecnología, INIA Las Brujas, Canelones, Uruguay.

2 DILAVE “Miguel C. Rubino”, Laboratorio Regional Este, Treinta y Tres, Uruguay.

3 Cátedra de Genética, Facultad de Veterinaria, UdelaR, Uruguay.

*,** Autores para correspondencia: Esta dirección electrónica esta protegida contra spambots. Es necesario activar Javascript para visualizarla Esta dirección electrónica esta protegida contra spambots. Es necesario activar Javascript para visualizarla

 


ver versión PDF.

Introducción | Materiales y Métodos | Resultados | Discusión | Conclusiones | Agradecimientos | Bibliografía

Resumen

La deficiencia en la adhesión leucocitaria bovina (BLAD) y en la enzima arginosuccinato sintetasa (Citrulinemia) son enfermedades de herencia autosómica recesiva que han sido descritas a nivel mundial en la raza Holando. El objetivo de este estudio fue optimizar e implementar una metodología de genotipado para la identificación de animales portadores de los alelos causantes de estas enfermedades en una población cohorte de terneras de recría de la raza Holando de la cuenca lechera de Cerro Largo. Las muestras de ADN de 190 terneras Holando fueron extraídas a partir de sangre fresca, siguiendo normas y protocolos del Banco de ADN de la Unidad de Biotecnología INIA Las Brujas. El genotipado fue realizado mediante análisis PCR-RFLP con las enzimas de restricción TaqI para BLAD y Eco47I (AvaII) para Citrulinemia. La confirmación del genotipado fue evaluada mediante secuenciación de los productos amplificados de ambas enfermedades. Se detectó la presencia del alelo mutante para BLAD en una sola ternera de recría y no se encontró portadoras de Citrulinemia en la población analizada. Este trabajo representó el primer relevamiento de la prevalencia génica de las enfermedades BLAD y Citrulinemia en la región Este del Uruguay.

Palabras clave: Bovinos de leche, BLAD, Citrulinemia, Enfermedades hereditarias letales, Genotipado.


Summary

Deficiency in bovine leukocyte adhesion (BLAD) and arginosuccinate synthase enzyme (Citrullinemia) are autosomal recessive diseases that have been described worldwide in the Holstein breed. The objective of this study was to optimize and implement a methodology of genotyping for the identification of animals carrying the allele causing these diseases in a population cohort of calves Holstein of dairy farm in Uruguay basin. DNA samples from 190 Holstein calves were extracted from fresh blood following rules and protocols DNA Bank Unit Biotechnology INIA Las Brujas. Genotyping was performed by PCR-RFLP analysis with restriction enzymes TaqI for BLAD and Eco47I (AvaII) for Citrullinemia. Results of RFLP genotyping were confirmed by sequencing of the amplified products of both diseases. The presence of the BLAD mutant allele was detected in only one calf while no Citrullinemia carriers were found in the analyzed population. This study represented the first survey of the prevalence of BLAD and Citrullinemia diseases of dairy cattle in the eastern region of Uruguay.

Keywords: Dairy cattle, BLAD, Citrullinemia, Lethal hereditary diseases, Genotyping


Introducción

La Deficiencia en la Adhesión Leucocitaria Bovina (BLAD) (OMIA 000595-9913) y en la enzima Arginosuccinato Sintetasa (Citrulinemia) (OMIA 000194-9913) son enfermedades de herencia autosómica recesiva que han sido descritas en la página web OMIA (http://omia.angis.org.au/), la cual recopila toda la información sobre estas dos enfermedades en bovinos de raza Holando.

BLAD está ampliamente difundida a nivel mundial siendo responsable de grandes pérdidas económicas (Llambí y col., 2003; Llambí y col., 2007; Kelly y col., 2010; Kelly y col., 2012; Meydan y col., 2010; Adamov y col., 2014). Su sintomatología extremadamente inespecífica determina la necesidad de implementar y validar las técnicas moleculares para la detección de alelos mutantes y mantener la calidad genética de las razas (Meydan y col., 2010; Kelly y col., 2012).

Los animales afectados mueren a causa de la extrema susceptibilidad a las infecciones, causada por la incapacidad de glóbulos blancos (leucocitos) para pasar al espacio extravascular en el tejido infectado (Muller y col., 1994). Esta enfermedad es producto de una mutación que afecta el funcionamiento de un receptor proteico en los leucocitos y en la respuesta inmune contra las infecciones. En la raza Holando, la enfermedad es causada por una mutación puntual que provoca un cambio de Adenina a Guanina (AàG, nucleótido 383, identificación del SNP -Polimorfismo de Nucleótido Simple: rs445709131) en el exón 4 de la subunidad beta-2 integrina del gen CD18 (Shuster y col., 1992) (ahora conocido como ITGB2) donde se produce una sustitución de un aminoácido por otro, del ácido aspártico por glicina en la posición 128 de la proteína del receptor (D128G).

La Citrulinemia es un desorden metabólico de herencia autosómica recesiva. Los signos clínicos de este desorden son consecuencia de una intoxicación por altos niveles de amoníaco en el cerebro de los terneros afectados, debido a una falla en el ciclo de la urea que surge de una deficiencia de una de las enzimas implicadas, argininosuccinato sintetasa (gen ASS1) (Healy y col., 1990). La mutación fue reportada por primera vez por Dennis y col. en el año 1989, que provoca un cambio de arginina (CGA/arginina) por un codón stop (TGA/codón stop) con pérdida de un sitio de restricción (AvaII) en el codón 86 del gen ASS1. Esta patología se ha diseminado en la raza Holando de Australia, EEUU y Europa por la importación del semen de un toro de pedigrí conocido mundialmente como “Linmarck Kriss King” (LKK, en siglas), de EE.UU. (Healy y col., 1990, 1991).

A nivel internacional está aceptado identificar en sus catálogos a los animales de pedigrí portadores de BLAD con las letras “BL” y aquellos que están libres de la enfermedad con las letras “TL”, y los portadores de Citrulinemia con las letras “CN” mientras que los libres llevan las letras “TC”.

El objetivo de este estudio consistió en optimizar e implementar una metodología de genotipado para la identificación de animales portadores de los alelos causantes de las enfermedades de origen genéticas BLAD y Citrulinemia, y estudiar la prevalencia de dichas enfermedades en una población cohorte de terneras de recría de la raza Holando de la cuenca lechera de Cerro Largo, Uruguay.

(Volver arriba)


 

Materiales y Métodos

A partir de las muestras de sangre de 190 terneras Holando de recría que son cohortes representativas de 30 predios lecheros de la cuenca lechera de Cerro Largo (Uruguay), se realizó el sangrado y las extracciones de glóbulos blancos siguiendo normas y protocolos (versión modificada del protocolo de Green y Sambrock, 2012) del Banco de ADN de la Unidad de Biotecnología INIA Las Brujas. La concentración del ADN fue determinada por nanodrop a 260 nm (NanoDrop 8000 spectrophotometer, Thermo Scientific) y su calidad fue determinada por la relación OD260/OD280.

 

Para la realización del genotipado, detección de terneras portadoras del alelo mutante recesivo de BLAD y Citrulinemia, se utilizaron las metodologías: PCR-RFLP y PCR-Secuenciación a modo de confirmación del análisis. Las secuencias de los primers, el programa del PCR, los tamaños de los productos de PCR y las digestiones con las enzimas de restricción para la identificación de cada genotipo de ambas enfermedades se muestran en el Cuadro I.

Cuadro I. Secuencias de los primers, programa de PCR y sus tamaños de los fragmentos esperados en la PCR y digestión con las enzimas para cada genotipo de ambas enfermedades

Enfermedad

hereditaria letal

Secuencia primer 5´a 3´

Programa PCR

Producto PCR

Enzima de restricción

Tamaños de los fragmentos según genotipo

Normal

Portador

Enfermo

BLAD (Mirck y col., 1995; Llambí y col., 2003)

BLAD-F: AGGCAGTTGCGTTCAACGTG

BLAD-R: CCGACTCGGTGATGCCATTGA

95ºC

5 m

1 ciclo

159 pb

TaqI

109-50 pb

159-109-50 pb

159 pb

62ºC

1 m

73ºC

1 m

95ºC

1 m

28 ciclos

62ºC

1 m

73ºC

1 m

95ºC

1 m

1 ciclo

62ºC

1 m

73ºC

5 m

Citrulinemia (Patel y col., 2006)

Citrulinemia-F:

GGCCAGGGACCGTGTTCATTGAGGACATC

Citrulinemia-R:

TTCCTGGGACCCCGTGAGACACATACTTG

94ºC

30 s

40 ciclos

185 pb

Eco47I (AvaII)

103-82 pb

185-103-82 pb

185 pb

55ºC

30 s

72ºC

30 s

Para determinar los genotipos de cada animal de ambas enfermedades se observó el número y tamaño de los fragmentos (Cuadro I) en geles de agarosa al 3% en buffer TBE 0.5X (Figuras 1 y 3).

Para la secuenciación de los productos de PCR de ambas enfermedades se utilizaron los mismos primers del análisis PCR-RFLP (para obtener las secuencias forward y reverse). Se realizó la búsqueda del SNP en los sitios de corte de las enzimas (TaqI y Eco47I, para BLAD y Citrulinemia, respectivamente) mediante observación de la superposición de los picos de fluorescencia en el electroferograma respectivo.

(Volver arriba)

 


Resultados

En la muestra poblacional de 190 terneras de recría analizadas mediante PCR-RFLP y Secuenciación se encontró una portadora heterocigota de BLAD (0,5%). No se encontraron animales homocigotas recesivos o enfermos de BLAD (Figura 1 y 2).

1         2        3         4           5          6         7           8        9        10        11

 

 

 

Figura 1: Digestiones con la enzima TaqI. Carril 1, marcador de peso molecular Gene Ruler Low Range DNA ladder; carril 2, animal heterocigota portador de BLAD; carriles 3-10, animales homocigotas dominantes normales; carril 11, control positivo de la digestión.

 

Figura 2: Electroferogramas de las terneras Holando normal (derecha) y portadora de BLAD (izquierda).

 

En Citrulinemia, mediante los análisis de PCR-RFLP y Secuenciación no se detectó el alelo mutado en esta población de terneras analizada (Figura 3 y 4).

 

1        2        3       4        5        6        7         8       9       10     11     12     13

 

 

 

 

Figura 3: Digestiones con la enzima Eco47I (AvaII). Carriles 1 y 13, marcador de peso molecular Gene Ruler Low Range DNA ladder; carriles 2-11, terneras homocigotas dominantes normales; carril 12, control positivo de la digestión.

 

 

Figura 4: Electroferograma de una ternera Holando libre de Citrulinemia, se muestra la secuencia forward obtenida señalando la posición en donde se encontraría la mutación.

(Volver arriba)



Discusión

La técnica de PCR-RFLP para identificar el alelo mutado normal permitió detectar una ternera portadora de BLAD. Esta técnica en nuestro país fue descrita por primera vez en bovinos Holando (Llambí y col., 2003) por la amplificación de la región del gen CD18 donde se localiza la mutación. Posteriormente, la enzima de restricción TaqI reconoció la mutación y cortó en este sitio permitiendo distinguir el alelo mutado del normal según la relación del tamaño y peso molecular dependiendo del largo en pares de bases (pb) del o los fragmentos resultantes. El patrón del fragmento de restricción obtenido con esta enzima en este estudio coincidió con los trabajos publicados previamente (Mirck y col., 1995, y Llambí y col., 2003).

Mediante la secuenciación del producto amplificado por PCR se confirmó el análisis de genotipado de las terneras libres y portadora de BLAD. El electroferograma de una ternera homocigota normal mostró solamente el nucleótido A en la posición 383 del gen CD18 bovino, mientras la portadora del alelo mutante reveló la presencia de dos nucleótidos (A y G) en la misma posición. En otras palabras, el sitio de reconocimiento por la enzima TaqI que identifica la mutación en la secuencia reverse es T por C y en la forward es A por G. Este estudio coincidió con los resultados publicados por Adamov y col. (2014) de secuenciación del producto amplificado por PCR aunque de mayor tamaño (341 pb) que el nuestro utilizando otro par de primers para identificar la mutación alélica recesiva de BLAD con la misma enzima.

La prevalencia génica detectada para BLAD para esta población fue sensiblemente menor a las reportadas previamente por Llambí y col. (2000; 2003), y Kelly y col. (2010) (0.5% vs 7.2% y 0.7%, respectivamente) en las poblaciones analizadas de la región Oeste de Uruguay. A nivel mundial, Meydan y col. (2010) obtuvo una prevalencia génica de 4.0% que fue muy similar en otros países. Sin embargo, hay un trabajo más reciente que obtuvo 2.2% (Adamov y col., 2014). La diferencia es probablemente el muestreo de diferentes poblaciones en las diferentes regiones y el tiempo transcurrido entre los estudios, aunque también podría ser por el uso de distintos reproductores, factor que afecta directamente la frecuencia génica de dicha enfermedad.

En el caso de la enfermedad Citrulinemia se siguió el protocolo de PCR propuesto por Patel y col. (2006) y se determinaron los genotipos normales no identificándose alelos mutantes.

El electroferograma de las terneras no portadoras de Citrulinemia mostró solamente el nucleótido C en el codón 86 del gen ASSl. Aunque no se encontró alguna portadora, el sitio de reconocimiento de la enzima Eco47I identificaría la mutación en la secuencia en la forward C por T en la misma posición del codón 86 de este gen.

Tampoco se encontraron animales portadores de Citrulinemia en los reportes de Llambí (2002), Kelly y col. (2010), y Meydan y col. (2010). En nuestro país hay sospechas clínicas y patológicas de Citrulinemia, aunque no se ha confirmado para lo que se requieren estudios poblacionales y pruebas de laboratorio (Comunicación personal: F. Dutra, DILAVE Treinta y Tres). Esta enfermedad había sido detectada en EE.UU y Australia (Healy y col., 1990, 1991). En Dinamarca se analizó una población de 72 toros Holando revelándose la ausencia del alelo mutante, aunque no se descartó la presencia de la enfermedad debido a que uno de los toros utilizados ampliamente en dicho país era nieto del toro LKK portador de Citrulinemia (Thomsen y Nielsen, 1991). Esto es probablemente por las diferencias en el uso de poblaciones de toros afectados entre las distintas regiones.

(Volver arriba)

 


Conclusiones

Mediante el análisis de PCR-RFLP y la confirmación por PCR-secuenciación se reveló la existencia del alelo mutante recesivo con una prevalencia génica de 0,5% para la enfermedad BLAD en la población estudiada confirmando que la mutación permanece en rodeos lecheros de nuestro país después de 15 años del primer diagnóstico. En la enfermedad hereditaria Citrulinemia las terneras de recría analizadas presentaron un genotipo normal no identificándose alelos mutantes. Este trabajo representó el primer relevamiento de la prevalencia génica de las enfermedades BLAD y Citrulinemia en la región Este del Uruguay.

(Volver arriba)



Agradecimientos

Al Dr. Gonzalo Macció de COLEME por su autorización y cooperación en el sangrado. Al Lic. P. Peraza, A. Vergara y C. Monzalvo del Banco de ADN Genómico Animal de INIA Las Brujas por su apoyo en el sangrado y las extracciones de glóbulos blancos.

(Volver arriba)



Bibliografía

 

  1. Adamov N, Mitrov D, Esmerov I, Dove P. (2014). Detection of recessive mutations (BLAD and CVM) in Holstein-Fresian cattle population in Republic of Macedonia. Mac Vet Rev 37:61-68.
  2. Dennis J, Healy P, Beaudet A, O´Brian W. (1989). Molecular definition of bovine argininosuccinate synthetase deficiency. Proc Natl Acad Sci 86:7947-7951.
  3. Green MR. (2012). (Michael Richard) & Sambrook, Joseph & Cold Spring Harbor Laboratory. Molecular cloning: a laboratory manual (4th ed. / Michael R. Green, Joseph Sambrook). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  4. Healy P, Dennis J, Camilleri L, Robinson J, Stell A, Shanks R. (1991). Bovine citrullinaemia traced back to the sire of linmack Kriss King. Aust Vet J 68:155-157.
  5. Healy P, Harper P, Dennis J. (1990). Bovine citrullinaemia: a clinical, pathological, biochemical and genetic study. Austr Vet J 67:255-258.
  6. Kelly L, Trenchi G, D’Agosto S, Ravagnolo O, Peraza P, Llambí S, Rivero R, Moraes J, Solares E, Dutra F. (2010). Molecular diagnosis of inherited diseases. World Buiatrics Congress XXVI. Santiago de Chile, Chile. Session Genetic and Breeding. p.31.
  7. Kelly L, Dutra F, Trenchi G, Llambí S, Rivero R, Moraes J, D´Agosto S, Peraza P, Ravagnolo O, Dalla Rizza M. (2012). Diagnóstico molecular de enfermedades bovinas hereditarias presentes en el Uruguay. Veterinaria (Montevideo) 48:3-11.
  8. Llambí S, Guevara K, Rincón G, Barrera J, Arruga, M.V, Postiglioni A. (2000). Diagnóstico Molecular de portadores de la enfermedad hereditaria BLAD en bovinos Holando-Uruguayo utilizando la técnica de PCR-RFLP (1er comunicación). World Buiatrics Congress XXI, Punta del Este, Uruguay. Session Genetic and Breeding. P 4081-4086.
  9. Llambí S. (2002). Estudios citogenéticos-moleculares de la fragilidad del cromosoma sexual X y enfermedades hereditarias monogénicas en bovinos de la raza Holando Uruguayo (Bos taurus). Tesis PhD. Universidad de Zaragoza, Zaragoza, España.
  10. Llambí S, Guevara K, Rincón G, Zaffaroni R, de Torres E, Barrera J, Arruga MV, Rodríguez V, Postiglioni A. (2003). Frequencia da deficiencia na adesão leucocitaria em uma população de bovinos da raça holandesa, no Uruguai. Ars. Veterinaria. 19:52-56.
  11. Llambí S, Nicolini P, Kelly L, de Torres E. (2007). Frecuencia de la enfermedad hereditaria BLAD en vacas Holando-Uruguayo con control de mastitis. Jornadas Técnicas Veterinaria-UdelaR V, Montevideo. Uruguay; pp 26-27.
  12. Meydan H, Yildiz MA, Agerholm JS. (2010). Screening for bovine leukocyte adhesion deficiency, deficiency of uridine monophosphate synthase, complex vertebral malformation, bovine citrullinaemia, and factor XI deficiency in Holstein cows reared in Turkey. Acta Vet Scand 52:56.
  13. Mirck M, Von Bannisseht W, Tiumermans-Besselink J, VanLuijk J, Buntjer J, Lenstra L. (1995). Optimization of the PCR test for the mutation causing bovine leukocyte adhesion deficiency. Cell and Mol. Biology 41:695-698.
  14. Müller K, Bernardina W, Kalsbeek H, Hoek A, Rutten V, Wentink G. (1994). Bovine leukocyte adhesion deficiency - clinical course and laboratory findings in eight affected animals. Vet. Q 16:65-71.
  15. Online Mendelian Inheritance in Animals (OMIA). Reprogen, Faculty of Veterinary Science, University of Sydney. World Wide Web URL: http://omia.angis.org.au/
  16. Patel RK, Singh KM, Soni KJ, Chauhan JB, Sambasiva Rao KRS. (2006). Lack of carriers of citrullinaemia and DUMPS in Indian Holstein cattle. J Appl Genet 47:239-242.
  17. Shuster DE, Bosworth BT, Kehrli ME. (1992). Sequence of the Bovine CD18-Encoding cDNA Comparison with the Human and Murine Glycoproteins. Gene 114:267-271.
  18. Thomsen P, Nielsen J. (1991). PCR screening for carriers of hereditary citrullinaemia in Danish Holstein-Friesian Bulls. Acta Vet Scand 32:279-282.

 

 

(Volver arriba)