Último Número: 208 Octubre-Diciembre 2017

Técnico: Tuberculosis aviar en Rhea americana (Ñandú) en cautividad en Uruguay. Diagnóstico bacteriológico y molecular

Technical: Avian tuberculosis in Rhea americana (Ñandú) in captivity in Uruguay. Bacteriologic and molecular diagnosis


Autor: Castro-Ramos M1*, Tiscornia I2, Lorenzo M2, Sanguinetti C2

1Laboratorio de Tuberculosis, Departamento de Bacteriología, División de Laboratorios Veterinarios (DILAV.) “Miguel C. Rubino”, Dirección General de Servicios Ganaderos (DGSG), Ministerio de Ganadería Agricultura y Pesca (MGAP), Montevideo, Uruguay. *Ruta 8 Brig. Gral. J. A. Lavalleja, km. 17,500, C.P. 12100, Montevideo, Uruguay. Correo Electrónico: Esta dirección electrónica esta protegida contra spambots. Es necesario activar Javascript para visualizarla

2Sección Bioquímica y Biología Molecular, Facultad de Ciencias, Universidad de la República (UdelaR), Montevideo, Uruguay.

Recibido: 30/4/2012 Aceptado: 23/9/2014


ver versión PDF.

Introducción | Materiales y Métodos | Resultados | Discusión | Conclusión | Bibliografía

 

Resumen

En Uruguay, entre los años 2001 y 2005, se estudiaron 262 ñandúes (Rhea americana) originarios de establecimientos de cría. Las aves provinieron de plantas de faena bajo Inspección Veterinaria. Los órganos estudiados fueron hígado y bazo. Se realizaron estudios bacteriológicos estandarizados de baciloscopía, aislamiento y pruebas bioquímicas, corroborando los resultados con técnicas moleculares. Se encontraron lesiones granulomatosas en los órganos de 72 aves. De los órganos sin lesiones de 24 Rhea americanas se obtuvo igual número de aislamientos. Se aislaron un total de 79 cepas de micobacterias: 77 Mycobacterium avium avium, 1 Mycobacterium intracellulare y 1 cepa de rápido crecimiento, Mycobacterium vaccae. En proyectos de erradicación de tuberculosis bovina es importante considerar la trasmisión interespecies. La prevención frente a la infección de M. avium en rodeos lecheros es fundamental. Por último, se debe preservar la salud de los empleados rurales, veterinarios e individuos inmunodeprimidos que viven en esas áreas de explotación.

Palabras Clave: Mycobacterium Rhea americana,Región ITS-PCR, zoonosis


Summary

In Uruguay, throughout 2001-2005, 262 samples of Rhea americana (Ñandú) from abattoirs under Veterinary Inspection belonging to productive farms were studied. The organs studied were liver and spleen. Standardized bacteriological studies of baciloscopy, isolation and biochemical tests were carried out, corroborating the results with techniques of molecular biology. Granulomatosis injuries were found in 72 samples. From 24 organs without injuries 24 mycobacterium were isolated. A total of 79 mycobacterium were isolated: 77 M. avium avium, 1 M. intracellulare and 1 stock of fast growth, M. vaccae. For eradication of bovine tuberculosis is important to consider the interspecies transmission. Prevention against M. avium infection in dairy production stocks is essential. Finally health of rural employees, veterinarian and immune-depresses individuals must be preserved in areas of these sort of productive farms.

Keywords: Mycobacterium, Rhea Americana, region ITS- PCR, zoonosis


Introducción

El complejo Mycobacterium avium (MAC) incluye los siguientes miembros de lento crecimiento Mycobacterium avium avium (Mav), Mycobacterium silvaticum, Mycobacterium hominissuis, Mycobacterium avium paratuberculosis, Mycobacterium colombiense y Mycobacterium intracellulare (Mintra), cuya distribución es omnipresente en el ambiente, principalmente (Mav) y (Mintra) (Brooks y col., 1984; George y col., 1980). La bibliografía sobre ocurrencia de tuberculosis aviar es abundante en casi todas las regiones geográficas del mundo (Dvorska y col., 2007; Murcia y col., 2006; Odiawo y Mukurira, 1988; Rubino, 1947; Saxegaard, 1981). Esta enfermedad se manifiesta en aves en cautiverio y en estado silvestre. Además causa enfermedad en animales domésticos como es el caso de cerdos y cabras (Jorgensen y col., 1972a; Jorgensen y col., 1972b). Hay comunicaciones de esta patología en visones (Mustela vison) y en coatíes (Nasua nasua) en cautiverio y en especies en estado silvestre como es el caso de ciervos rojos en Escocia (Errico y col., 2010; Huitema, 1970).

En humanos, las especies del MAC se asocian con patologías como enfermedades genito-urinarias, linfadenitis cervicales en niños, enfermedad pulmonar crónica en adultos e infecciones en individuos con SIDA (Correa y Correa, 1974; De José y col., 1999; Hoffner y col., 1990; Inderlied y col., 1993). Con la pandemia de VIH/SIDA, el bacilo tuberculoso aviar tiene una preponderancia muy particular con respecto a la salud humana (Baquero-Artigao, 2005; Braselli, 1996; Horsburgh, 1986; Yakrus y Good, 1990). En Argentina y Uruguay la presencia del MAC, es constante en numerosas investigaciones en las décadas de 1970 y 1980, desarrolladas tanto a nivel animal como humano (Barrera y Kantor, 1987; Castro-Ramos y col., 2001; Errico y Bermúdez, 1980; Errico y col., 1988; Sáenz y Errico, 1984).

Entre los años 2000-2006 en nuestro país, la cría del ñandú en cautividad como alternativa agropecuaria trajo como consecuencia la aparición de algunas patologías, entre ellas la tuberculosis aviar, las que fueron comunicadas por primera vez en 2004 (Giossa y col., 2004). Esta patología no tiene tratamiento en producción animal por lo que las medidas sanitarias deben apuntar a bajar la incidencia de la enfermedad (AUCRIÑA Asociación Uruguaya de Criadores de Rhea americana). Con respecto al aislamiento de cepas del MAC en ñandú hay escasa información. (Huitema, 1970; Jorge y col., 2007, Sanford y col., 1994; Tacconi y Valente, 1981).

El objetivo de este trabajo es reportar los aislamientos de micobacterias en ñandúes, realizados en Uruguay durante el período 2001-2005 y caracterizarlos mediante estudios bacteriológicos y moleculares.

(Volver arriba)

 


 

 

Materiales y Métodos

Origen de las muestras

Durante el período 2001-2005, se procesaron 262 muestras de órganos de ñandúes en el Laboratorio de Tuberculosis de la División de Laboratorios Veterinarios (DILAVE) “Miguel C. Rubino”. Dichas muestras debidamente protocolizadas provenían de plantas de faena habilitadas a esos efectos bajo Inspección Veterinaria del Ministerio de Ganadería Agricultura y Pesca. Según los datos obtenidos de los protocolos enviados, estas muestras eran de aves de establecimientos de cría, dispersos en 11 departamentos del país (Cuadro 1).

Cuadro 1. Número y origen de las muestras procesadas durante 2001-2005

Departamento

Aves

S/D

7

Canelones

8

Colonia

37

Flores

1

Florida

40

Maldonado

62

Montevideo

2

Paysandú

5

Río Negro

14

Rocha

3

San José

2

Soriano

81

TOTAL

262

S/D: Sin datos

Todo órgano con o sin lesiones granulomatosas se remitía refrigerado al laboratorio por parte de la Inspección Veterinaria Oficial de la División de Industria Animal. Los órganos enviados fueron: bazo, hígado y en una ocasión también peritoneo. En el laboratorio se trabajó con cabina de bioseguridad clase II A/B3. La homogeneización de las muestras se efectuó con un equipo de trituración (Stomacher 400, Seward, Laboratory Blender). Los materiales se centrifugaron con camisa de bioseguridad (IEC). El quemado de las asas luego de la siembra se hizo en un incinerador eléctrico y las siembras se depositaron en estufas de cultivo exclusivas para el cultivo de micobacterias.

Aislamiento e identificación

El procesamiento de descontaminación de las muestras se cumplió de acuerdo al método del ácido oxálico al 5% (Tacquet y col., 1967). La baciloscopía y el aislamiento se realizaron cumpliendo los métodos descriptos por el Centro Panamericano de Zoonosis (Centro Panamericano de Zoonosis, 1979). Las cepas aisladas se identificaron en base al aspecto microscópico (Ziehl-Neelsen), tiempo de desarrollo, comparación entre los medios de Löwenstein-Jensen y Stonebrink, morfología de las colonias, cromogenicidad, fotocromogenicidad, y temperatura de crecimiento. Además se complementó con pruebas bioquímicas de acuerdo a los métodos ya descriptos (Centro Panamericano de Zoonosis, 1979; OIE, 2000; Runyon y col., 1980).

Estudios moleculares

Se analizaron 35 cepas por técnicas moleculares de las cuales 6 eran cepas de referencia: M. bovis, AN5 Rotterdam CDI, Holland; M. avium D4 ER, Weybridge, UK; M. tuberculosis, H37Rv ATCC27294; M. intracellulare 1403 TMCC (Trudeau Mycobacterial Culture Colletion); M. xenopi, (OPS/ OMS), M. avium paratuberculosis Cepa 18 y 29 cepas aisladas de Rhea americana. La estrategia abordada consistió en extraer el ADN a partir de una suspensión de bacterias, amplificarlo por PCR y hacer restricción enzimática y/o secuenciación de la región ITS. Esta región es muy variable y se ha utilizado extensamente para estudiar la variabilidad dentro del complejo MAC (Turenne y col., 2007).

Extracción de ADN Se utilizó el kit de extracción de ATGen Sistemas Moleculares realizando modificaciones al protocolo del fabricante. El ADN se resuspendió en H20 miliQ y se conservó a 4ºC.

Amplificación por PCR. Los cebadores y las condiciones de amplificación para el ADN correspondiente a la región espaciadora entre 16S-23S del ARN fueron las descriptas por (Roth y col., 2000). Los cebadores fueron:

sp1 5’ACCTCCTTTCTAAGGAGCACC3’

sp2 5’GATGCTCGCAACCACTATCCA3’

El fragmento amplificado esperado variaba entre 200 pb y 350 pb, dependiendo de la especie de micobacteria (314 pb para M. terrae, 220 pb para M. intracellulare, 219 pb para M. avium, 205 pb para M. xenopi, 200 pb para M. tuberculosis y M. bovis).

La mezcla de reacción (volumen final 20 µl) consistió en la combinación de 2 µl de Buffer STR 10X (50 mM KCl2, 1.5 mM MgCl2, 0.1% Tritón X-100 y 0.2 mM de cada dNTP), 0.5 µl de oligonucleótidos (sp1 + sp2, 10mM), 1 µl de Taq polimerasa Cenbiot (1U/ul), H2O miliQ (14.5µl) y ADN (2µl).

Las condiciones de amplificación para esta región fueron: una desnaturalización inicial de 5 minutos a 94°C, 38 ciclos que consistieron en una desnaturalización a 94°C, 1 min; una hibridación a 59°C, 1 min; una extensión a 72°C, 1 min; y una extensión final de 5 minutos a 72°C.

 

Digestión enzimática de la región ITS con HaeIII. Al producto amplificado de la región 16S‐23S se le agregó 1,25U de la enzima de restricción HaeIII (NEB) y se incubó 2 horas a 37°C; la enzima fue posteriormente inactivada por calor (10 minutos a 65°C).

 

Electroforesis en gel de poliacrilamida. Los productos amplificados por PCR se visualizaron en geles no desnaturalizantes de poliacrilamida 6%, mientras que los productos de las digestiones enzimáticas se visualizaron en geles al 10%.

Purificación del producto amplificado. Para la purificación del producto amplificado por PCR se utilizó un kit de Qiagen (Quiaquick PCR Purification Kit 50) siguiendo las instrucciones del fabricante.

Secuenciación del producto de PCR de la región ITS. El producto amplificado de la región ITS utilizando el cebador Sp1 se secuenció en el Centro Técnico de Análisis Genéticos (CTAG) de la Facultad de Ciencias. La reacción de secuencia se realizó según el protocolo del CTAG y se utilizaron los cebadores correspondientes. Se obtuvieron 31 secuencias de esta región de las cuales 27 fueron utilizadas para el análisis. Las 4 secuencias restantes fueron descartadas en la etapa de edición. Para identificar las secuencias obtenidas se utilizó el programa BLAST (Altschul y col., 1997) (www.ncbi.nlm.nih.gov/BLAST/).

Edición y alineamiento de secuencias. Las secuencias obtenidas fueron comparadas con la base de datos del Gen Bank utilizando el programa BLAST y editadas manualmente. El alineamiento se realizó con el programa CLUSTAL X (versión1.81).

Análisis filogenético. Para la obtención de los árboles filogenéticos se utilizó el programa Molecular Evolution Genetic Analisis versión 3, (Kumar y col., 2004) (MEGA 3, http://www.megasoftware.net/). Se utilizaron los métodos de máxima parsimonia (MP) y Neighbour Joining (NJ).

(Volver arriba)

 


Resultados

De los 262 materiales procesados, 72 presentaban lesiones granulomatosas y 190 no presentaban lesiones (Figura 1).

 

 

Figura 1. Hígado afectado con múltiples lesiones granulomatosas típicas producidas por miembros micobacterianos del complejo Mycobacterium avium (MAC).

 

De los materiales con lesiones solamente se obtuvieron 55 cepas y de los 17 materiales restantes no se obtuvieron aislamientos. La baciloscopía positiva de los sedimentos sembrados correspondió a 58 de las 262 muestras estudiadas (22,13%) (Figura 2).

 

Figura 2. Frotis del sedimento de hígado sembrado, se observan BAAR (flechas), con la morfología característica de Mycobacterium avium. (Técnica de Z-N, 1000x).

En 4 materiales con baciloscopía positiva no se obtuvieron aislamientos. De 24 materiales sin lesiones, se lograron 24 aislamientos. Al comparar los dos métodos de caracterización: bacteriológico y molecular, el total de aislamientos fue de 79 (30,72%): 77 M. avium, 1 M. intracellulare, 1 M. vaccae. (Cuadro 2)

Cuadro 2. Resultados obtenidos a partir de pruebas bioquímicas y moleculares

Nº de muestra

Pruebas bioquímicas

Producto PCR

BIOLOGIA

Hae III

MOLECULAR

Secuencia

1

M. tuberculosis H37Rv (cepa de referencia)

250

--------

--------

2

M. bovis AN5 (cepa de referencia)

210

M. bovis

M tub /M. bovis

3

M. avium D4 (cepa de referencia)

210

M. avium

M. avium

4

M. intracellulare 1403 (cepa de referencia)

220

M.intracellulare

M.intracellulare

7

M. avium

210

--------

M. avium

8

M. avium

210

M. avium

--------

9

M. avium

210

M. avium

M. avium

10

M. avium

300

--------

--------

11

M. avium

210

M. avium

M. avium

12

M. avium

210

M. avium

M. avium

13

M. avium

210

M. avium

M. avium

14

M. avium

210

M. avium

M. avium

15

M. avium

210

M. avium

M. avium

16

M. avium

210

--------

M. avium

17

M. fortuitum

300

--------

M. vaccae

18

M. avium

210

--------

M. avium

19

M. avium

210

--------

M. avium

20

M. avium

210

--------

M. avium

21

M. avium

210

--------

--------

22

M. avium

210

--------

M. avium

23

M. avium

210

--------

M. avium

24

M. avium

210

--------

M. avium

25

M. avium

210

--------

M. avium

26

M. avium

210

--------

M. avium

27

M. avium

210

--------

M. avium

28

M. avium

210

--------

M. avium

29

M. avium

210

--------

M. avium

30

MAC

210

--------

M. avium

40

M. xenopi (cepa de referencia)

210

M. xenopi

M. xenopi

41

MAC

210

M. avium

M. avium

42

MAC

250

M. avium

M. avium

43

MAC

210

M. avium

M. avium

44

MAC

220

intra

M. avium

45

MAC

210

M. avium

M. avium

46

M. avium sub. paratuberculosis (cepa de referencia)

210

M. avium

M. avium

 

Se indica el tamaño del producto de PCR obtenido, y la especie (o subespecie) propuesta de acuerdo a la digestión enzimática y a la secuenciación. Se muestran las secuencias obtenidas,

 

Amplificación por PCR de la región ITS. Del total de aislamientos, 29 de ellos fueron derivados para estudios moleculares.

Se obtuvo ADN de calidad adecuada para su posterior amplificación para todas las muestras analizadas.

En la Figura 3 se muestra un gel representativo con el resultado de la amplificación de las muestras 7, 8, 10, 16, 17 (carriles 2-6). Las muestras 7, 8 y 16 presentan una banda de 210 pb, mientras que la 10 y la 17 presentan una banda de 300 pb.

 

Figura 3. Resultado de la amplificación por PCR de la región ITS. Carril 1: PM, carriles 2-6: muestras 7, 8, 10, 16, 17, carril 7: control negativo.

Se obtuvo la amplificación del producto de interés para todas las muestras analizadas. Los fragmentos obtenidos para las cepas de referencia y las muestras fueron:

- 210 pb para las muestras: 2 (cepa de referencia M. bovis AN5), 3 (cepa de referencia M. avium D4 ER), 7-9, 11-16, 18-30, 40 (cepa de referencia M. xenopi), 43, 45, 46 (cepa de referencia M. avium sub paratuberculosis).

- 220 pb para las muestras: 4 (cepa de referencia M. intracellulare 1403) y 44.

- 250 pb para las muestras: 1, 41 y 42.

- 300 pb para las muestras: 10 y 17.

En base al tamaño del producto de PCR no pudo realizarse una identificación debido a que varias especies coincidían en el tamaño de banda, por lo que se abordaron dos estrategias para identificar los aislamientos: digestión enzimática con Hae III y secuenciación del producto amplificado por PCR.

Los resultados mostraban que al realizar la digestión enzimática de una misma muestra, los datos fueron concordantes, a excepción de la muestra 44, a la cual la restricción coincidía con fragmentos del tamaño de M. intracellulare y la secuencia se correspondió con M. avium. Se obtuvieron 36 secuencias, las cuales fueron utilizadas para el análisis final.

Los resultados de la comparación de las secuencias con el programa BLAST, fueron los siguientes:

. M. avium: muestras 3, 5, 7, 9, 11-16, 18-20, 22-31, 34, 36, 37, 41, 42, 43, 44, 46.

. M. tuberculosis/M. bovis: muestra 2.

Todas las secuencias de M. intracellulare presentaban la región común: GGAGGCCGGT.

Los resultados de las pruebas bioquímicas coincidían con los obtenidos de la digestión con HaeIII. En algunos casos (muestras 32, 34, 35, 37, 41-45) se lograban mayor discriminación con la restricción enzimática, ya que permitió identificar cual era la especie dentro de los complejos de micobacterias.

(Volver arriba)


Discusión

métodos bacteriológicos y de biología molecular PCR en ñandú con un número importante de aves. Para el caso de las técnicas de biología molecular empleadas, los resultados de las pruebas culturales y bioquímicas no coincidían en todos los casos con el de la secuencia. Tal fue el caso de la muestra 17, siendo M. vaccae y no M. fortuitum como resultado de la identificación bioquímica. Con esta muestra debería haberse repetido la secuencia y la digestión enzimática para descartar un posible error experimental, pero el error fue debido a una lectura equivocada de una prueba cultural de fotocrogenicidad que discriminaba M. vaccae de M. fortutuim.

Todas las secuencias de M. avium presentaban la región común: GGGGGCCGGGT

Todas las secuencias de M. bovis presentaban la región común: GAGAGCCGGT.

En base a los resultados obtenidos podemos decir que la amplificación por PCR y la restricción enzimática de la región ITS resulta la mejor estrategia para la identificación del agente etiológico causante de la infección, ya que fue concordante con el análisis de métodos bioquímicos tradicionales. Esta metodología fue más rápida que la bioquímica que se ejecutó periódicamente y pudo considerarse como método de rutina. En el área de la biología molecular los resultados concordaron con lo reportado en la bibliografía (Frothingham y Wilson, 1993; Roth y col., 2000; Turenne y col. 2007). Con los resultados obtenidos, mediante la edición y alineamiento de secuencias y además con la elaboración de uno de los árboles filogenéticos, se visualizó la circulación y origen de las cepas aisladas en los diferentes predios estudiados. Era el caso de las cepas 9, 16 y 19 que formaron un grupo asociado a una procedencia común del departamento de Florida. Las cepas 22, 27 (Soriano) y la 19, (Florida) formaron un mismo grupo. A su vez la cepa 20 (Florida) y las cepas 23 y 28 (Soriano) también se agruparon. El árbol filogenético mostró los primeros hallazgos efectuados en Florida , corroborado por los primeros números individuales de referencia de los aislamientos (Figura 4).

Figura 4. Árbol realizado con el método NJ con un Bootstrap de 100. Cepas 9, 16, 19 y 20 originarias de Florida (estrellas verdes); 22, 27 y 28 originarias de Soriano (estrellas naranjas). Tomado de Lorenzo y Tiscornia, 2004.

En un trabajo previo, de una faena de 158 aves encontraron tuberculosis, salmonelosis y diversos tipos de parásitos (Giossa y col., 2004). Al incrementarse la comercialización aumentó el caudal de información por el diagnóstico de rutina del Laboratorio Oficial de Tuberculosis, debido a las sucesivas faenas de ñandúes entre los años 2001-2005, de distintos departamentos y establecimientos de cría. Los datos bacteriológicos y moleculares recogidos en el presente estudio corroboraban las investigaciones efectuadas por nuestro equipo (Giossa y col., 2004), y otros autores (Jorge y col., 2007; Sáenz y Errico, 1984; Tacconi y Valente, 1981). Mediante ambas técnicas de caracterización del agente etiológico, se pudieron comparar los resultados que aseguran un porcentaje muy alto para llegar al diagnóstico final, con solamente 2 cepas de las estudiadas que diferían del método bacteriológico clásico.

 

Los datos obtenidos en este trabajo resultaron de gran interés dado que en nuestro país, la prevalencia de la tuberculosis bovina es de 0.012% por lo que se encuentra en etapa de erradicación de la enfermedad (Zumárraga y col., 1999). Nuestros resultados coincidieron con anteriores estudios (Castro-Ramos y col., 2001; Errico y Bermúdez, 1980; Errico y col., 1988; Sáenz y Errico, 1984) que mostraban un incremento sostenido en los aislamientos de cepas del complejo M. avium en los últimos treinta años en nuestro país. Dos de estos trabajos ubicaban a M. avium (23%), en segundo lugar detrás de M. bovis (65%).

Es importante destacar que M. avium pudo interferir dando reacciones cruzadas con la prueba tuberculínica en los rodeos lecheros (Lesslie, 1970b). Por lo tanto es preciso subrayar que en los programas de erradicación de tuberculosis bovina se debería tener en cuenta la interrelación de la tuberculosis entre especies. Se deben tomar medidas sanitarias necesarias para que M. bovis luego de erradicado, no sea suplantado por cepas del complejo aviar. La importancia de comunicar estos datos aún luego de pasado el apogeo de los criaderos de ñandúes y de la casi extinción de ellos, dejaba en evidencia el desconocimiento de las diferentes patologías (salmonelosis, tuberculosis, parasitosis, etc.) y el criterio productivo-sanitario de estas aves.

(Volver arriba)


Conclusiones

Esta era la primera comunicación en el país de aislamiento de M. avium avium en Rhea americana, en un número tan elevado de muestras procesadas. Se deberán extremar las medidas preventivas y de control para lograr que M. avium no infecte rodeos lecheros ni a especies de explotación agropecuaria (aves ponedoras y cerdos, etc.).

Se concluye que se deberá prevenir esta zoonosis con normativas sanitarias en relación a los humanos que actúan en estas tareas: trabajadores rurales, veterinarios y personas inmuno-comprometidas, mediante desinfección de predios, galpones y materiales de crianza (incubadoras, jaulas, comederos, etc.).

(Volver arriba)


Agradecimientos

- A los Dres. R. Ehrlich (Ex -Decano de la Facultad de Ciencias, Universidad de la República (UdelaR), y E. Perdomo –in memoriam-(Ex -Director de la DILAVE “Miguel C. Rubino”), por el apoyo institucional y técnico al inicio y durante el transcurso de estos estudios.

- Al Centro Técnico de Análisis Genéticos (CTAG) de la Facultad de Ciencias, UdelaR, cuyo servicio realizó la secuenciación.

- A la Dra. G. Pedrana (MSc), Facultad de Veterinaria, UdelaR, por la traducción al idioma inglés del resumen del manuscrito.

- A la Dra. M. Silva-Paravís (Departamento de Bacteriología, DILAVE “Miguel C. Rubino”, por la colaboración en la selección de las muestras remitidas.

- Al Dr. G. Giossa (Facultad de Veterinaria, UdelaR), por las fotografías aportadas para el trabajo.

- Al Dr. F. Errico, por la lectura crítica del manuscrito.

- A la Dra. (MSc) Helena Katz, por colaboración en la edición de figuras y textos.

(Volver arriba)



Bibliografía

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. (1997). Gapped BLAST and PSI-BLAST:a new generation of protein database search programs. Nucleic Acids Res 25:3389-402.

Baquero-Artigao F. (2005). Infección pediátrica por micobacterias no tuberculosas. An Pediatr (Barc) 62:458-466.

Barrera L, Kantor IN de (1987). Nontuberculous mycobacteria and Mycobacterium bovis as a cause of human disease in Argentina. Trop Geogr Med 39:222-227.

Bono M, Jemmi T, Bernasconi C, Burki D, Telenti A, Bodmer T. (1995). Genotypic characterization of Mycobacterium avium strains recovered from animals and their comparison to human strains. Appl Environ Microbiol 61:371-373.

Braselli A. (1996). Situación clinicoepidemiológica en relación al VIH. En: Jornadas de Tuberculosis y Micobacteriosis Atípicas. Centenario del Instituto de Higiene, Facultad de Medicina, Montevideo, Uruguay.

Brooks RW, Parker BC, Gruft H, Falkinham JO.(1984). Epidemiology of infection by nontuberculous mycobacteria. V . Numbers in eastern United States soils and correlation with soil characteristics. Am Rev Respir Dis 130:630-633.

Castro Ramos M, Llerena P, Errico F, Muller G, Neirotti V, Silva Paravís M, Silvera FV, César D, Berisso H. (2001), Mycobacterias aisladas en la División de Laboratorios Veterinarios (DILAVE) “Miguel C. Rubino” en el período 1979-1999. En: Encuentro Nacional de Microbiólogos, 5°, Montevideo, Uruguay. Libro de Resúmenes, Montevideo, Sociedad Uruguaya de Microbiología, Facultad de Ciencias, pp. 21.

Centro Panamericano de Zoonosis, OPS/OMS. (1979). Bacteriología de la tuberculosis humana y animal. (Dra. I. N. de Kantor). Serie Monografías Científicas y Técnicas, CPZ-11, 63 pp.

Chin DP, Hopewell PC, Yajko DM, Vittinghoff E, Horsburgh CH Jr, Hadley WK. et al. (1994): Mycobacterium avium complex in the respiratory or gastrointestinal tract and the risk of M. avium bacteremia in patients with human immunodeficiency virus infection. J. Infect. Dis. 169:289-295.

Correa WM, Correa CNM. (1974). Micobactérias patogénicas do Grupo III de Runyon. Ocorrencia m enfermos no Brasil. Arq. Inst. Biol., Sao Paulo 41:135-139.

Cromie RL, Brown MJ, Price DJ. Stanford JL. (1991). Susceptibility of captive wildfowl to avian tuberculosis : the importance of genetic and environmental factors. Tubercle 72:105-109.

De José MI, Baquero-Artigao F, & the Spanish Pediatric-AIDS Collaborative Group. (1999). Disseminated Mycobacterium avium complex infection in HIV-infected spanish children. Berlin: 9th European Congress of Clinical Microbiology and Infectious Diseases.

Di Lonardo M, Isola NG, Ambroggi M, Fulladosa G, Kantor IN. (1983). Enfermedad producida por Micobacterias no Tuberculosas en Buenos Aires, Argentina. Bol. Of. Sanit. Panam. 95:134-140.

du Moulin GC, Stottmeier KD. (1978). Use of Cetylpyridinium Chloride in the decontamination of Water for Culture of Mycobacteria. Applied and Enviromental Microbiology 36:771-773.

Dvorska L, Matlova L, Ayele WY, Fischer OA, Amemori T, Weston RT, Alvarez J, Beran V, Moravkova M, Pavlik I. (2007).Avian tuberculosis in naturally infected captive water birds of the Ardeideae and Threskiornithidae families studied by serotyping, IS901 RFLP typing, and virulence for poultry. Vet Microbiol 119:366-374.

Errico F, Bermúdez J. (1980). Identificación de Mycobacterias en suinos. Veterinaria (Montevideo) 17:117-119.

Errico F, Castro Ramos M, Silvera FV. (1988). Identificación de cepas de micobacterias aisladas en el Centro de Investigaciones Veterinarias (C.I.VET.) “Miguel C. Rubino” entre 1981-1986. Veterinaria (Montevideo) 24:9-13.

Errico F, Silva-Paravís M, Castro-Ramos M. (2010). Aislamiento de Complejo Mycobacterium avium (MAC) en parques zoológicos y reservas de fauna de Uruguay en el período 1978 – 2008. Veterinaria (Montevideo) 46:177–180.

Falkinham JO, Nichols G, Bartram J, Dufour A, Portaels F. (2004). Natural ecology and survival in water of mycobacteria of potential public health significance. World Health Organitazion. Pathogenic Mycobacteria in Water: A Guide to Public Health Consequences, Monitoring and Management. Edited by S. Pedley, J. Bartram, G. Rees, A. Dufour and J. Cotruvo.

Frothingham R, Wilson KH. (1993). Sequence-based differentiation of strains in the Mycobacterium avium complex. J Bacteriol 175:2818-225

George KL, Parker BC, Gruft H, Falkinham J O. (1980). Epidemiology of infection by nontuberculous mycobacteria II Growth and survival in natural waters. Am Rev Respir Dis. 122: 89-94.

Giossa G, Trenchi H, Castro Ramos M, Morgades D, de Souza G, Castro O, Casas L, Salazar M, Perdomo L, Venzal J. (2004). Hallazgos Bacteriológicos y Parasitológicos en una faena de ñandú (Rhea americana) Veterinaria, (Montevideo) 39:11-16.

Gossle S, Wolinsky E. (1976). Water as a Source of Potentially Pathogenic Mycobacteria. Am Rev Respir Dis 113:287-292.

Hazra R, Robson CD, Perez-Atayde AR, Husson RN. (1999). Lymphadenitis due to nontuberculous mycobacteria in children: presentation and response to therapy. Clin Infect Dis 28:123-129

Hoffner SE, Kallenius G, Petrini B, Brennan PJ, Tsang AY. (1990). Serovars of Mycobacterium avium Complex Isolated from Patients in Sweden. J Clin Microbiol, 28:1105-1107.

Horsburgh CR. Jr., Cohn DL, Roberts RB, Masur H, Miller RA, Tsang AY, Iseman MD.(1986). Mycobacterium avium-M. intracellulare isolates from patients with or without acquired immunodeficiency syndrome. Antimicrob Agents Chemother 30:955-957.

http://www.aucrina.org..uy/Articles/Aspectos tecnicos /Sanidad/3/ AUCRIÑA Asociación Uruguaya de Criadores de Rhea americana.

Huitema H. (1970). First international seminar on bovine tuberculosis for the Americas, 83-92 (Santiago de Chile) 21-25 September.

Inderlied CB, Kemper CA, Bermudez LE. (1993). The Mycobacterium avium complex. Clin Microbiol Rev 6:266-310

Jorge MC, Traversa MJ, Schettino DM, Bernardelli A, Zumárraga M, Cataldi A, Romero C, Grand HM. (2007). Tuberculosis en Rhea americana y Gallus sp. en cautiverio. In Vet Volumen 9,

Jorgensen JB, Engbaek HC, Dam A. (1972a). An Enzootic of Pulmonary Tuberculosis in Pigs caused by M. avium 2. Bacteriological Studies. Acta Vet. Scand 13:68-86.

Jorgensen JB, Haarbo K, Dam A, Engbaek HC. (1972b). An Enzootic of Pulmonary Tuberculosis in Pigs caused by M. avium 1. Epidemiological and Pathological Studies. Acta Vet Scand 13:56-67.

Kearns KS. (2003). Micobacteriosis aviar In: Recent Advances in Avian infectious Diseases, K. S. Kearns and B. Loudis (Eds.). Publisher: International Veterinary Information Service (www.ivis.org), Ithaca, New York, USA.

Kumar S, Tamura K, Nei M. (2004). MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 5:150-163.

Lesslie IW. (1970b). Infección por Mycobacterium avium y su relación con la erradicación de la tuberculosis  bovina. First International seminar on bovine tuberculosis for the Americas, 77-81 (Santiago de Chile) 21-25 September, 1970b.

Meissner G, Anz W. (1977). Sources of Mycobacterium Avium Complex Infection. Resulting in Human Diseases. Am Rev Respir Dis 116:1057-1064.

39. Montali, R. J.; Bush, M.; Thoen, C. O.; Smith, E. (1976): Tuberculosis in Captive Exotic Birds, JAVMA, Vol 169, N°9, November I.

Murcia MI,Tortoli E, Menendez MC, Palenque E, Garcia MJ. (2006). Mycobacterium colombiense sp. nov., a novel member of the Mycobacterium avium complex and description of MAC-X as a new ITS genetic variant. Int J of Syst Evol Microbiol 56:2049-2054.

Odiawo GO, Mukurira JM. (1988). Avian cerebral tuberculosis. Vet Rec 122:279-280.

OIE (2000). Chapter 2.7.8 Avian tuberculosis, Manual of Standards for Diagnostic Tests and Vaccines.

Olivier KN, Weber DJ, Wallace RJ Jr, Faiz AR, Lee JH, Zhang Y. et al. (2003). Nontuberculous mycobacteria I: Multicenter prevalence study in cystic fibrosis. Am J Respir Crit Care Me 167:828-834

Pavlik I, Svastova P, Bartl J, Rychlik I. (2000). Relationship between IS901 in the Mycobacterium avium complex strains isolated from birds, animals, humans and environment and virulence for poultry. Clin Diag Lab Inmunol 7:212-217.

45. Ritacco, V.; Kremer, K.; Van Der Laan, T.; Pijnenburg, J. E. M.; De Haas, P. E. W.; Van Soolingen, D. (1997): use of IS901 and IS1245 in RFLP typing of Mycobacterium avium complex : relatedness among serovar reference strains, human and animal isolates. Int. J. Tuberculosis Lung Dis., 2, 242-251.

Roth A, Reischl U, Streubel A, Naumann L, Kroppenstadt RM, Habicht M, Fischer M, Mauch H. (2000). Novel diagnostic for identification of Mycobacteria using genus-specific amplification of the 16S-23SrRNA gene spacer and restriction endonucleoses. J Clin Microbiol 38:1094-1104

Rubino MC. (1945. Compilación de Trabajos Científicos del Dr. Miguel C. Rubino, f) Tuberculosis en las aves. 1ª Ed., Ministerio de Ganadería y Agricultura República Oriental del Uruguay. Impresora Uruguaya S.A. Pág. 42.

Runyon EH, Karlson AG, Kubica GP, Wayne LG. (1980). Mycobacterium. En: Lennette, E.H. Manual of Clinical Microbiology 3a ed. Washington D.C. American Society for Microbiology.pp 150-179.

Sáenz A, Errico F. (1984). Mycobacteria isolated from apparently normal swine lymph nodes in Uruguay. Bull Pan Am Health organ 18:63-68.

Sanford H, Rehmtulla A, Josephson C. (1994). Tuberculosis in farmed rheas. Avian Dis 38:193-196.

Saxegaard F. (1981). Serological investigations of Mycobacterium avium and M. avium-like bacteria isolated from domestic and wild animals. Acta Vet Scand 22:153-161.

Tacconi G, Valente C. (1981). Studi un caso di tubercolosi del nandu (Rhea americana) Riv Zootec Vet 9:234-236

Tacquet A, Tison F, Devulder B, Roos P. (1967). Tecniques for decontamination pathological specimens for culturing Mycobacteria. Bull Int Union against Tuberc 39:21-24

Thoen CO, Himes EM. (1981). Infectious Diseases of Wild Mammals Tuberculosis, Second Edition, Edited by Davis JN, Karstad LH, Trainer DO, The Iowa State University Press, AMES IOWA, USA, 263-274 pp.

Thorel MF, Huchzermeyer H, Weiss R, Fontaine JJ. (1997). Mycobacterium avium infections in animals. Literature review. Vet Res 28:439-447.

Turenne CY, Wallace R Behr MA. (2007). Mycobacterium avium in the postgenomic era. Clin Microbiol Rev 20:205-229.

Yakrus MA, Good R. (1990). Geographic Distribution, Frequency, and Specimen Source of Mycobacterium avium Complex Serotypes Isolated from Patients with Acquired Immunodeficiency Syndrome. J Clin Microbiol 28:926-929.

Young LS, Inderfied CB, Berlin OG, Gottlieb MS. (1986). Mycobacterial infections in AIDS patients, with an emphasis on the Mycobacterium avium complex. Rev Infect Dis 8:1024-1033.

Zumárraga MJ, Martin C, Samper S, Alito A, Latini O, Bigi F, Roxo E, Cicuta ME, Errico F, Castro Ramos M, Cataldi A, van Soolingen D, Romano MI. (1999). Usefulness of Spoligotyping of Mycobacterium bovis-Related infections in South America. J Clin Microbiol 37:296-303.

(Volver arriba)